Mature sequence aly-miR169c-5p

Accession numberMIMAT0017489
IDaly-miR169c-5p
Previous IDsaly-miR169c
Stem-Loop aly-MIR169c
Sequence
cagccaaggaugacuugccgg
Get sequence
Deep sequencing86 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).