Mature sequence aly-miR166g-3p

Accession numberMIMAT0017472
IDaly-miR166g-3p
Previous IDsaly-miR166g
Stem-Loop aly-MIR166g
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing137 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).