Mature sequence aly-miR165b-3p

Accession numberMIMAT0017458
IDaly-miR165b-3p
Previous IDsaly-miR165b
Stem-Loop aly-MIR165b
Sequence
ucggaccaggcuucaucccc
Get sequence
Deep sequencing114 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).