Mature sequence aly-miR165a-3p

Accession numberMIMAT0017456
IDaly-miR165a-3p
Previous IDsaly-miR165a
Stem-Loop aly-MIR165a
Sequence
ucggaccaggcuucaucccc
Get sequence
Deep sequencing113 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).