Mature sequence bta-miR-3432a

Accession numberMIMAT0017396
IDbta-miR-3432a
Previous IDsbta-miR-3432
Stem-Loop bta-mir-3432a-1 bta-mir-3432a-2
Sequence
ugcgggaucuuuaguuguggug
Get sequence
Deep sequencing9409 reads, 68 experiments
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).