Mature sequence hsa-miR-2277-5p

Accession numberMIMAT0017352
IDhsa-miR-2277-5p
Stem-Loop hsa-mir-2277
Sequence
agcgcgggcugagcgcugccaguc
Get sequence
Deep sequencing1260 reads, 119 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).