Mature sequence mmu-miR-669m-5p

Accession numberMIMAT0017346
IDmmu-miR-669m-5p
Stem-Loop mmu-mir-669m-1 mmu-mir-669m-2
Sequence
ugugugcaugugcauguguguau
Get sequence
Deep sequencing11075 reads, 100 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).