Mature sequence rno-miR-505-5p

Accession numberMIMAT0017226
IDrno-miR-505-5p
Previous IDsrno-miR-505*
Stem-Loop rno-mir-505
Sequence
gggagccaggaaguauugauguu
Get sequence
Deep sequencing735 reads, 236 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).