Mature sequence rno-miR-451-3p

Accession numberMIMAT0017193
IDrno-miR-451-3p
Previous IDsrno-miR-451*
Stem-Loop rno-mir-451
Sequence
augguaaugguucucuugcugcu
Get sequence
Deep sequencing2486 reads, 199 experiments
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).