Mature sequence rno-miR-329-5p

Accession numberMIMAT0017031
IDrno-miR-329-5p
Previous IDsrno-miR-329*
Stem-Loop rno-mir-329
Sequence
agagguuuucugggucucuguuuc
Get sequence
Deep sequencing32027 reads, 334 experiments
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).