Mature sequence aae-miR-iab-4-3p

Accession numberMIMAT0016977
IDaae-miR-iab-4-3p
Stem-Loop aae-mir-iab-4-1 aae-mir-iab-4-2
Sequence
cgguauaccuucaguauacguaac
Get sequence
Deep sequencing4 reads, 1 experiments

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).