Mature sequence bta-miR-26c

Accession numberMIMAT0016938
IDbta-miR-26c
Previous IDsbta-miR-3603
Stem-Loop bta-mir-26c
Sequence
agccuauccuggauuacuugaa
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).