Mature sequence hsa-miR-4259

Accession numberMIMAT0016880
IDhsa-miR-4259
Stem-Loop hsa-mir-4259
Sequence
caguugggucuaggggucagga
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).