Mature sequence hsa-miR-4324

Accession numberMIMAT0016876
IDhsa-miR-4324
Stem-Loop hsa-mir-4324
Sequence
cccugagacccuaaccuuaa
Get sequence
Deep sequencing9704 reads, 111 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).