Mature sequence hsa-miR-4313

Accession numberMIMAT0016865
IDhsa-miR-4313
Stem-Loop hsa-mir-4313
Sequence
agcccccuggccccaaaccc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).