Mature sequence hsa-miR-4301

Accession numberMIMAT0016850
IDhsa-miR-4301
Stem-Loop hsa-mir-4301
Sequence
ucccacuacuucacuuguga
Get sequence
Deep sequencing1734 reads, 99 experiments
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).