Mature sequence cin-miR-4186-5p

Accession numberMIMAT0016804
IDcin-miR-4186-5p
Stem-Loop cin-mir-4186
Sequence
cuagaugaggcaagagugag
Get sequence
Deep sequencing16 reads, 2 experiments

References

1