Mature sequence cin-miR-4181-3p

Accession numberMIMAT0016795
IDcin-miR-4181-3p
Stem-Loop cin-mir-4181
Sequence
gaacgucaggcugacacaau
Get sequence
Deep sequencing reads, experiments

References

1