Mature sequence cin-miR-4177-3p

Accession numberMIMAT0016787
IDcin-miR-4177-3p
Stem-Loop cin-mir-4177
Sequence
uaauugcuguuuuaaaaaua
Get sequence
Deep sequencing1 reads, 1 experiments

References

1