Mature sequence cin-miR-4084-3p

Accession numberMIMAT0016658
IDcin-miR-4084-3p
Stem-Loop cin-mir-4084
Sequence
aaacaauuaucagaagauuuc
Get sequence
Deep sequencing1 reads, 1 experiments

References

1