Mature sequence cin-miR-4061-3p

Accession numberMIMAT0016611
IDcin-miR-4061-3p
Stem-Loop cin-mir-4061
Sequence
aacacucuggcguuccguca
Get sequence
Deep sequencing12 reads, 2 experiments

References

1