Mature sequence cin-miR-4061-5p

Accession numberMIMAT0016610
IDcin-miR-4061-5p
Stem-Loop cin-mir-4061
Sequence
aggcggucccucagaugguu
Get sequence
Deep sequencing457 reads, 2 experiments

References

1