Mature sequence cin-miR-4060-3p

Accession numberMIMAT0016609
IDcin-miR-4060-3p
Stem-Loop cin-mir-4060
Sequence
agccguuguugcagugaagu
Get sequence
Deep sequencing100 reads, 2 experiments

References

1