Mature sequence cin-miR-4060-5p

Accession numberMIMAT0016608
IDcin-miR-4060-5p
Stem-Loop cin-mir-4060
Sequence
auuucacucuuucaacuguu
Get sequence
Deep sequencing167 reads, 2 experiments

References

1