Mature sequence cin-miR-4038-5p

Accession numberMIMAT0016565
IDcin-miR-4038-5p
Stem-Loop cin-mir-4038
Sequence
cggucaauaccagaugcaaa
Get sequence
Deep sequencing25 reads, 2 experiments

References

1