Mature sequence cin-miR-4037-3p

Accession numberMIMAT0016564
IDcin-miR-4037-3p
Stem-Loop cin-mir-4037
Sequence
cggacaacgauggcaaugcu
Get sequence
Deep sequencing42 reads, 2 experiments

References

1