Mature sequence cin-miR-4037-5p

Accession numberMIMAT0016563
IDcin-miR-4037-5p
Stem-Loop cin-mir-4037
Sequence
acaauugcacucgucuguaccg
Get sequence
Deep sequencing10779 reads, 2 experiments

References

1