Mature sequence cin-miR-4024-3p

Accession numberMIMAT0016540
IDcin-miR-4024-3p
Stem-Loop cin-mir-4024
Sequence
uuucaucuuuugauccuaug
Get sequence
Deep sequencing reads, experiments

References

1