Mature sequence cin-miR-4019-3p

Accession numberMIMAT0016527
IDcin-miR-4019-3p
Stem-Loop cin-mir-4019
Sequence
cccguuccaacaauguuccg
Get sequence
Deep sequencing reads, experiments

References

1