Mature sequence cin-miR-4013a-3p

Accession numberMIMAT0016515
IDcin-miR-4013a-3p
Stem-Loop cin-mir-4013a
Sequence
uaggcugcuaaugcaagccc
Get sequence
Deep sequencing2 reads, 2 experiments

References

1