Mature sequence cin-miR-4013a-5p

Accession numberMIMAT0016514
IDcin-miR-4013a-5p
Stem-Loop cin-mir-4013a
Sequence
agacuuguaauagcagcaug
Get sequence
Deep sequencing11 reads, 1 experiments

References

1