Mature sequence cin-miR-4008a-3p

Accession numberMIMAT0016496
IDcin-miR-4008a-3p
Stem-Loop cin-mir-4008a
Sequence
aggguuuauccugucugcca
Get sequence
Deep sequencing13 reads, 2 experiments

References

1