Mature sequence cin-miR-1502c-3p

Accession numberMIMAT0016492
IDcin-miR-1502c-3p
Stem-Loop cin-mir-1502c
Sequence
aggguuuuucauggaguucg
Get sequence
Deep sequencing102 reads, 2 experiments

References

1