Mature sequence cin-miR-4003a-3p

Accession numberMIMAT0016462
IDcin-miR-4003a-3p
Stem-Loop cin-mir-4003a-1 cin-mir-4003a-2 cin-mir-4003a-3
Sequence
caagaauuuuaaccaacaca
Get sequence
Deep sequencing reads, experiments

References

1