Mature sequence cin-miR-4003a-5p

Accession numberMIMAT0016461
IDcin-miR-4003a-5p
Stem-Loop cin-mir-4003a-1 cin-mir-4003a-2 cin-mir-4003a-3 cin-mir-4003a-4
Sequence
ugaguugguuauacauucuu
Get sequence
Deep sequencing1038 reads, 2 experiments

References

1