Mature sequence cin-miR-375-3p

Accession numberMIMAT0016418
IDcin-miR-375-3p
Stem-Loop cin-mir-375
Sequence
cuuguucguucggcucgcgu
Get sequence
Deep sequencing4 reads, 1 experiments

References

1