Mature sequence cin-miR-375-5p

Accession numberMIMAT0016417
IDcin-miR-375-5p
Stem-Loop cin-mir-375
Sequence
acguuggucgcacgaucaaa
Get sequence
Deep sequencing1 reads, 1 experiments

References

1