Mature sequence gga-miR-3535

Accession numberMIMAT0016386
IDgga-miR-3535
Stem-Loop gga-mir-3535
Sequence
ggauaugaugacugauuaucugaaa
Get sequence
Deep sequencing1026 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).