Mature sequence sja-miR-10-3p

Accession numberMIMAT0016254
IDsja-miR-10-3p
Stem-Loop sja-mir-10
Sequence
aaauucgagucuauaaggaaaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).