Mature sequence ppy-miR-1302

Accession numberMIMAT0016222
IDppy-miR-1302
Stem-Loop ppy-mir-1302-1 ppy-mir-1302-2 ppy-mir-1302-3 ppy-mir-1302-4 ppy-mir-1302-2
Sequence
uugggacauacuuaugcuaaa
Get sequence
Deep sequencing reads, experiments

References

1