Mature sequence ppy-miR-1228

Accession numberMIMAT0016164
IDppy-miR-1228
Stem-Loop ppy-mir-1228
Sequence
ucacaccugccucacccccc
Get sequence
Deep sequencing reads, experiments

References

1