Mature sequence ppy-miR-653

Accession numberMIMAT0016086
IDppy-miR-653
Stem-Loop ppy-mir-653
Sequence
guguugaaacaaucucuacug
Get sequence
Deep sequencing reads, experiments

References

1