Mature sequence ppy-miR-609

Accession numberMIMAT0016050
IDppy-miR-609
Stem-Loop ppy-mir-609
Sequence
agaguguugcucucaucucu
Get sequence
Deep sequencing reads, experiments

References

1