Mature sequence ppy-miR-603

Accession numberMIMAT0016045
IDppy-miR-603
Stem-Loop ppy-mir-603
Sequence
cacacacugcaauuacuuuugc
Get sequence
Deep sequencing reads, experiments

References

1