Mature sequence ppy-miR-587

Accession numberMIMAT0016029
IDppy-miR-587
Stem-Loop ppy-mir-587
Sequence
uuuccauaggugaugagucac
Get sequence
Deep sequencing reads, experiments

References

1