Mature sequence ppy-miR-455-5p

Accession numberMIMAT0015899
IDppy-miR-455-5p
Stem-Loop ppy-mir-455
Sequence
uaugugccuuuggacuacaucg
Get sequence
Deep sequencing reads, experiments

References

1