Mature sequence ppy-miR-377

Accession numberMIMAT0015867
IDppy-miR-377
Stem-Loop ppy-mir-377
Sequence
aucacacaaaggcaacuuuugu
Get sequence
Deep sequencing reads, experiments

References

1