Mature sequence ppy-miR-342-3p

Accession numberMIMAT0015845
IDppy-miR-342-3p
Stem-Loop ppy-mir-342
Sequence
ucucacacagaaaucgcacccgu
Get sequence
Deep sequencing reads, experiments

References

1