Mature sequence ppy-miR-296-3p

Accession numberMIMAT0015810
IDppy-miR-296-3p
Stem-Loop ppy-mir-296
Sequence
gaggguuggguggaggcucucc
Get sequence
Deep sequencing reads, experiments

References

1