Mature sequence ppy-miR-139-3p

Accession numberMIMAT0015762
IDppy-miR-139-3p
Stem-Loop ppy-mir-139
Sequence
ggagacgcggcccuguuggagu
Get sequence
Deep sequencing reads, experiments

References

1